Austrian Institute Of Technology PICME

Login







Barcodes

Trigonella Barcodes

 

Species: Trigonella foenum-graecum L. (Trigonella foenum-graecum)
Tissue: Leaf
Plate_Barcode/Position: 0000023270/A1
Library: Medicinal plants
RBCL Sequence: AACAGAGACTAAAGCAAAGGTTGGGTTCAAAGCTGGTGTTAAAGATTATA AATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTG GCAGCATTCCGAGTAAGTCCTCAACCTGGAGTTCCTGCTGAAGAAGCAGG TGCAGCGGTAGCTGCCGAATCTTCCACTGGGACATGGACAACTGTGTGGA CCGATGGACTTACCAGTCTTGATCGTTATAAAGGACGCTGCTACCACATC GAGCCTGTTGCTGGCGAAGATAATCAATTTATTGCTTATGTAGCTTATCC CTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCCATTG TAGGTAATGTATTTGGGTTCAAGGCCTTGCGCGCTCTACGTCTGGAAGAT TTGCGAATCCCAGTTGCTTATGTTAAAACTTTCCAAGGCCCTCCTCACGG AATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCTTATTGG GATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGA GCAGTTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGA AAATGTGAACTCCCAACCATTTATGCGTTGGA
MATK Sequence: GTATATATTTTATTTGATACAAACTTTTTTTTTTTGAGGATCCATTGTAA TAATGAGAAAGATTTCTGCATATTCGCAAAAATCGGTCAATAATATCAAA ATCGGATGAATCGGCCCAGACCGGCTTACTAATAGGATGTCCTAATACAT TACAAAATTTAGCTTTAGCCAAGGATCTAATTAGAGGCATAATTGGAACT ATTATATCAAGTTTTTTGCTAACAATTTCGATTAGAAATGTATTTTGCAA CATTTGACTCCGTACCACTGAACGATTTAGCCGCACATTTAAAAAATAGC CTAAAAGCTGAAATGAATGTTCGGATAATTGGTTTATATTGATCGTTCTT GGTTGAGACCAAACATCAAAAAAACCTTGCCATAAATGGATAAAATAGTG TTTCCATTTATTCATCAAAAAAGGCGCATTCTTTGAAGCCAGAATGCATT TTCCTTGATATCTAACATAATGAATGAGAGGATCCTTGAAAAATGTTAAA GGATACGAAAAATCTTTAGCAAAAACTTCTACAAGATGTTCTCTTTTTGC ATAAAAAAAAATTCGTTCAAAAAAAACGCTAAAAGATTTTAATCGTAAAT GAGAGGATTTATTACGTAGAAAAAGGAAGATAGATTCATATTCACATACA TAAAAATTATAGAGGAACAAGAAGAATCTCGGATTCCTTTTTGAAAAAGT AGAAATCGATTTTTTGGTAGTAATAAAACTATTCCAATTACAAAAATTAT AAAGAAACAATCGTAATAAATGAAAAA

 

Species: Trigonella foenum-graecum L. (Trigonella foenum-graecum)
Tissue: Leaf
Plate_Barcode/Position: 0000023270/B1
Library: Medicinal plants
RBCL Sequence: AACAGAGACTAAAGCAAAGGTTGGGTTCAAAGCTGGTGTTAAAGATTATA AATTGACTTATTATACTCCTGACTATGAAACCAAAGATACTGATATCTTG GCAGCATTCCGAGTAAGTCCTCAACCTGGAGTTCCTGCTGAAGAAGCAGG TGCAGCGGTAGCTGCCGAATCTTCCACTGGGACATGGACAACTGTGTGGA CCGATGGACTTACCAGTCTTGATCGTTATAAAGGACGCTGCTACCACATC GAGCCTGTTGCTGGCGAAGATAATCAATTTATTGCTTATGTAGCTTATCC CTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACCTCCATTG TAGGTAATGTATTTGGGTTCAAGGCCTTGCGCGCTCTACGTCTGGAAGAT TTGCGAATCCCAGTTGCTTATGTTAAAACTTTCCAAGGCCCTCCTCACGG AATCCAAGTTGAGAGAGATAAATTGAACAAGTATGGACGTCCCTTATTGG GATGTACTATTAAACCTAAATTGGGGTTATCCGCTAAGAATTACGGTAGA GCAGTTTATGAATGTCTACGCGGTGGACTTGATTTTACCAAAGATGATGA AAATGTGAACTCCCAACCATTTATGCGTTGGA
MATK Sequence: GTATATATTTTATTTGATACAAACTTTTTTTTTTTGAGGATCCATTGTAA TAATGAGAAAGATTTCTGCATATTCGCAAAAATCGGTCAATAATATCAAA ATCGGATGAATCGGCCCAGACCGGCTTACTAATAGGATGTCCTAATACAT TACAAAATTTAGCTTTAGCCAAGGATCTAATTAGAGGCATAATTGGAACT ATTATATCAAGTTTTTTGCTAACAATTTCGATTAGAAATGTATTTTGCAA CATTTGACTCCGTACCACTGAACGATTTAGCCGCACATTTAAAAAATAGC CTAAAAGCTGAAATGAATGTTCGGATAATTGGTTTATATTGATCGTTCTT GGTTGAGACCAAACATCAAAAAAACCTTGCCATAAATGGATAAAATAGTG TTTCCATTTATTCATCAAAAAAGGCGCATTCTTTGAAGCCAGAATGCATT TTCCTTGATATCTAACATAATGAATGAGAGGATCCTTGAAAAATGTTAAA GGATACGAAAAATCTTTAGCAAAAACTTCTACAAGATGTTCTCTTTTTGC ATAAAAAAAAATTCGTTCAAAAAAAACGCTAAAAGATTTTAATCGTAAAT GAGAGGATTTATTACGTAGAAAAAGGAAGATAGATTCATATTCACATACA TAAAAATTATAGAGGAACAAGAAGAATCTCGGATTCCTTTTTGAAAAAGT AGAAATCGATTTTTTGGTAGTAATAAAACTATTCCAATTACAAAAATTAT AAAGAAACAATCGTAATAAATGAAAAA